/ 0

Store

Mucopolysaccharidosis VI (Miniature Schnauzer Type)

$50

(ONLINE PRICE)

ADD TO CART

Test Overview:

Mucopolysaccharidosis VI (Miniature Schnauzer Type) is an inherited Lysosomal Storage Disorder. Affected dogs have insufficient activity of the Enzyme beta-glucuronidase, which is responsible for breaking down glycosaminoglycans (GAGs). GAGs are an important component of Connective Tissue. In affected dogs, there is an accumulation of breakdown products in cells causing abnormal growth and function of various organ systems. Clinical signs of MPS VI are most commonly associated with accumulations in the bones and joints. Affected dogs have variable clinical signs, but MPS is suspected when dogs show developmental abnormalities such as stunted growth, enlarged head with a pronounced underbite, and abnormal spinal alignment. A veterinarian may assess internal organ abnormalities using an ultrasound. While affected dogs can survive with assistance for several years, they are often euthanised due to a poor quality of life.

Category:

Haemolymphatic - Associated with the blood and lymph

Gene:

ARSB

Variant Detected:

chr3:28031524-28031579 (canFam4): GGCGGCGGGGCCGCGGGCCGCGAAGGATGTGCG GGCGCGGGGCGGCCAGCCTGCCC/-

Severity:

Moderate. This disease can cause significant signs of discomfort and/or dysfunction in affected animals. It may involve relatively high treatment/management costs, and can sometimes reduce life expectancy.

Mode of Inheritance:

Autosomal Recessive

Recommended Screening:

Genetic testing of the ARSB gene will reliably determine if a dog is a genetic carrier of mucopolysaccharidosis VI (Miniature Schnauzer Type).

Research Citation(s):

Perez ML, Kridel HA, Gallagher A, Sheppard BJ, Reese S, Kondo H, Alleman R, Giger U. Mucopolysaccharidosis type VI in a juvenile miniature schnauzer dog with concurrent hypertriglyceridemia, necrotizing pancreatitis, and diabetic ketoacidosis. Can Vet J. 2015 Mar;56(3):272-7. [PubMed: 25750448] Raj K, Berman-Booty L, Foureman P, Giger U. ARSB gene variants causing Mucopolysaccharidosis VI in Miniature Pinscher and Miniature Schnauzer dogs. Anim Genet. 2020 Dec;51(6):982-986. [PubMed: 32985704]

Associated Breed(s):

Miniature Schnauzer,

##parent-placeholder-8bfb4e1aa590eab8f08f837b97acf5803a5737ed##